Blog

Simulating adaptive immune receptor repertoire sequencing runs with InSilicoSeq 2.0

Recently, the manuscript of the updated read simulation tool InSilicoSeq came out in preprint1 (BioRXiv) and on GitHub (InSilicoSeq 2.0). The main purpose of this package is to generate synthetic datasets that imitate real-world scenarios so that scientists and programmers can validate and optimize bioinformatics tools, statistical algorithms, and analytical pipelines. To extend the InSilicoSeq package from its origin as meta-genome simulator to support the simulation of reads from amplicon-based sequencing protocols, we collaborated with the original package author Hadrien Gourlé. At ENPICOM, we specifically use this package for simulating immune repertoire sequencing (AIRR-seq) data for benchmarking and testing.

In this blog, we would like to showcase how to simulate realistic AIRR sequencing data using InSilicoSeq 2.0 and demonstrate how we use such a golden-standard dataset to test our own ENPICOM Platform. In particular, we are going to test the error correction functionality that uses several reads from the same template to construct a consensus receptor sequencing. To do this, we are going to simulate paired-end reads from immune receptors with a UMI barcode included (Figure 1) using the new amplicon-generation feature that is now included in InSilicoSeq. For every step, we will provide code and an example file so that you can easily reproduce this workflow or adapt it to your own needs.

Figure 1. Template to be constructed for read simulation. It consists of a unique molecular identifier (UMI), a spacer, and an immunoglobulin heavy chain receptor (IGH).
Figure 1. Template to be constructed for read simulation. It consists of a unique molecular identifier (UMI), a spacer, and an immunoglobulin heavy chain receptor (IGH).

What is InSilicoSeq?

InSilicoSeq is a software package fully written in Python that can simulate realistic Illumina-like sequencing reads for a variety of sequencing machines and assay types. Originally created by H. Gourlé et al.2, version 2.0 now supports amplicon-based sequencing that enables simulation of AIRR sequencing data1. InSilicoSeq comes with pre-made error models of various quality levels for Illumina MiSeq, Hiseq, NovaSeq, and NextSeq sequencing platforms while it also provides the flexibility to generate custom error models. It has improved computational performance with a reduced memory footprint compared to the original implementation. In this blog post, we will demonstrate the novel amplicon-based sequencing capability, how strongly the simulated reads resemble the PHRED scores of actual sequencing data, and how this data can be used to test tools. If you would like to learn more, you can read the manuscript available on the BioRXiv preprint server.

Generating Immunoglobulin heavy (IGH) receptor sequences

First, we generate a set of receptor sequences that will serve as the repertoire that will be used to generate reads. The R-package immuneSim3 published by the Greiff lab provides a good and easy-to-use option to generate realistic Human Immunoglobulin (IG) heavy-chain receptors. ImmuneSIM enables in silico generation of single and paired chain human and mouse B- and T-cell repertoires. The simulation algorithm encompasses an in silico VDJ recombination process with on-the-go detailed annotation of the generated sequences and, if enabled by the user, somatic hypermutation (SHM) and sequence motif implantation.

The panel below demonstrates the R-code used to generate a small set of 1000 Human Ig heavy chain receptor sequences without somatic hypermutations that will serve as the input to generate paired-end reads using InSilicoSeq 2.0. The output of the R-code is provided in the panel below the code. To make the simulated data more realistic, we added a unique molecular identifier (UMI) consisting of 10 random nucleotides followed by a short spacer sequence of "ACGT" to indicate the boundary between the end of the UMI and the start of the receptor sequence.

R-script to generate Ig heavy receptor sequences
# install the latest version directly from the Greiff-lab GitHub# install the devtools packageinstall.packages("devtools") # load devtools and install immuneSIM from githublibrary(devtools)install_github("GreiffLab/immuneSIM") # load immuneSimlibrary(immuneSIM) # simulate human immunoglobuline heavy repertoire without# somatic hyper mutations sim_repertoire <- immuneSIM(  number_of_seqs = 1000,  species = "hs",  receptor = "ig",  chain = "h",  shm.mode = "none",  name_repertoire = "hs_igh_naive_01") # for better tractability add an identifier to each receptorinstall.packages('dplyr')library(dplyr)sim_repertoire <- sim_repertoire %>% mutate(  "id" = row_number()) # create UMI functionnucleotides <- c("A", "C", "T", "G")generate_umi <- function(n){  replicate(    n = n,    paste(      sample(        x = nucleotides,        size = 10,        replace = TRUE        ),      collapse = ""    )  )} # generate UMIsim_repertoire <- sim_repertoire %>% mutate(  umi = generate_umi(    n=nrow(sim_repertoire)  )) # generate spacerspacer_sequence = "ACGT" # write the ImmunseSim  data-frame to a tsv filewrite.table(  x = sim_repertoire,  file = "immuneSim.tsv",  quote = FALSE,  sep = '\t',  col.names = TRUE,  row.names = FALSE)

Creating InSilicoSeq input-files: Fasta library and read-count file

The test amplicon templates are constructed by concatenating the UMI, spacer, and receptor sequences. For each template the value of the column id (an integer ranging from 1 to 1000) is used as the template name. This way, we can always validate the template sequences by checking the receptor sequence in the immuneSim.tsv file. We used the R-package seqinr4 to write the amplicon templates to a fasta-formatted file. The library file contains the final amplicon templates that can be used by InSilicoSeq 2.0 as templates to generate the forward and reverse reads. Here we provide the fasta-file and the R-code to write the fasta file.

R-script to generate the fasta-library file based on an ImmuneSim
# write the receptor sequences to a fasta formatted fileinstall.packages('seqinr')library(seqinr)write.fasta(  sequences = as.list(    paste0(      sim_repertoire$umi,      spacer_sequence,      sim_repertoire$sequence      )    ),  names = sim_repertoire$id,  file.out = "",  open = "w")

Next, we will create the read-count file. The read-count file contains the number of reads to be generated for each fasta template in the library file. This example code generates 10 reads for each of the 1000 amplicon templates in the library file. Using this read-count file produces a simulation with 5000 forward, and 5000 reverse reads, a grand total of 10⁴ reads.

R-script to generate read-count file based on an ImmuneSim
# write a read-count file to tell InSilicoSeq how many reads to generate for# each receptor. For each receptor we will generate 10 readsread_count_table <- data.frame(  id = sim_repertoire$id,  count = 10) write.table(  x = read_count_table,  file = "hs_igh_naive_01_read_counts.tsv",  quote = FALSE,  sep = '\t',  col.names = FALSE,  row.names = FALSE)

Installing InSilicoSeq

Now that the required library and read-count files have been generated, InSilicoSeq can be installed to start generating the simulated reads. You can install it directly onto your system via the easy-to-use python3 pip module.

#install InSilicoSeqpip install InSilicoSeq# check if installation was successfuliss generate --help

Or, alternatively you can choose to use the (biocontainer) docker-image of InSilicoSeq:

# pull docker from repodocker pull quay.io/biocontainers/insilicoseq:2.0.0--pyh7cba7a3_0 # check if docker worksdocker run quay.io/biocontainers/insilicoseq:2.0.0--pyh7cba7a3_0 \  iss generate --help

Running InSilicoSeq

InSilicoSeq can generate both (meta-)genome and amplicon-based reads. In this example, we use the generate function to simulate reads. We set the --sequence_type parameter to amplicon to simulate amplicon-based sequencing reads. With the --model parameter, we select the error model miseq. Error model miseq is a precomputed error model based on paired-end reads of 301 base pairs generated by an Illumina MiSeq platform (see preprint for more details). For the --genomes parameter we use the previously generated hs_igh_naive_01.fasta file, containing 1000 amplicon templates. We set --readcount_file to hs_igh_naive_01_read_counts.tsv indicating that 10 reads should be generated for each amplicon template. The number of reads to generate is specified per sequence, so any number will do. Since there are error models based on single reads and read-pairs, the counts file contains the total number of reads. In this example we selected the miseq paired-end error model in combination with a total count of 10 reads per amplicon template. This combination of error model and read count file will result in 5 read-pairs. Providing a read count file containing uneven number of reads in combination with a paired-end results in one incomplete pair.

We are using a prefix of hs_igh_naive_01 to name the output meta and fastq files in the current working directory (${PWD}/hs_igh_naive_01). The optional parameter --store_mutations enables that the errors introduced by InSilicoSeq in each read will to be stored as a vcf-formatted file. The --cpus parameter dictates how many CPUs can be used by InSilicoSeq. Putting together these parameters will lead to the following command to simulate reads with InSilicoSeq:

Running InSilicoSeq generate
iss generate \  --sequence_type amplicon \  --model "miseq" \  --genomes "hs_igh_naive_01.fasta" \  --readcount_file "hs_igh_naive_01_read_counts.tsv" \  --output "${PWD}/hs_igh_naive_01" \  --store_mutations \  --cpus 4

Or, alternatively, run the InSilicoSeq docker image in the folder containing the hs_igh_naive_01.fasta and hs_igh_naive_01_read_counts.tsv files.

Running InSilicoSeq generate using docker
docker run \  -v $PWD/:/input/ \  -t quay.io/biocontainers/insilicoseq:2.0.0--pyh7cba7a3_0 \  iss generate \  --sequence_type amplicon \  --model "miseq" \  --genomes /input/hs_igh_naive_01.fasta \  --readcount_file /input/hs_igh_naive_01_read_counts.tsv \  --output /input/hs_igh_naive_01 \  --store_mutations \  --cpus 1

Running the command above generated the simulated forward (hs_igh_naive_01_R1.fastq) and reverse reads (hs_igh_naive_01_R2.fastq) each containing 5000 reads. The file hs_igh_naive_01.vcf contains the position of the errors introduced by InSilicoSeq for each individual read. Based on these files, we can further explore the features of the simulated AIRR data.

InSilicoSeq produces realistic quality (PHRED) scores

The selection of the error model influences the quality of the simulated data. The FastQC5 tool and fastqcr6 R-package can be used to visualize the average per-base quality PHRED7 scores of the forward and reverse reads generated by the precomputed miseq model. Figure 2 shows the per-base average quality scores of the forward (red line) and reverse reads (green line) of empirical MiSeq data (A) and simulated MiSeq data (B).

Figure 2. Per-base quality score comparison of empirical and simulated data. The mean quality scores of the forward reads are indicated by a red line and reverse reads by a green line. Subfigure A shows the per-base mean quality scores of empirical MiSeq data and B shows the per-base mean quality scores of simulated MiSeq data. PHRED quality scores are analysed by FastQC and the figures are generated by the R-package fastqcr.
Figure 2. Per-base quality score comparison of empirical and simulated data. The mean quality scores of the forward reads are indicated by a red line and reverse reads by a green line. Subfigure A shows the per-base mean quality scores of empirical MiSeq data and B shows the per-base mean quality scores of simulated MiSeq data. PHRED quality scores are analysed by FastQC and the figures are generated by the R-package fastqcr.

Besides the precomputed miseq error model, InSilicoSeq contains precomputed error models from different sequencing platforms and of various quality classes. Table 1 contains the complete overview of the available error models and Figure 3 shows the per-base quality score for each model. InSilicoSeq also has the option (iss model) to create a custom error model based on any BAM file.

Error modelSequencing platformRead lengthFilters
NextSeqNextSeq2x 301bpNone
MiSeqMiSeq2x 301bpNone
MiSeq-20MiSeq2x 301bpAverage PHRED score >= 20
MiSeq-24MiSeq2x 301bpAverage PHRED score >= 24
MiSeq-28MiSeq2x 301bpAverage PHRED score >= 28
MiSeq-32MiSeq2x 301bpAverage PHRED score >= 32
MiSeq-36MiSeq2x 301bpAverage PHRED score >= 36
HiSeqHiSeq2x125bpNone
NovaSeqNovaSeq2x150bpNone

Table 1: Overview of the pre-computed error models for different Illumina sequencing platforms that are available through the InSilicoSeq 2.0 command line interface (cli). For the MiSeq error model, we have created 5 different quality classes by filtering paired reads with different minimal averaged quality scores.

Figure 3. Overview of available error models in InSilicoSeq 2.0. The mean quality scores of the forward reads are indicated by a red line and reverse reads by a green line. Each subfigure shows the per-base mean quality scores for the precomputed error models: MiSeq (A), MiSeq-20 (B), MiSeq-24 (C), MiSeq-28 (D), MiSeq-32 (E), MiSeq-36 (F), NextSeq (G), NovaSeq (H) and HiSeq (I). PHRED quality scores are analyzed by FastQC and the figures are generated by the R-package fastqcr.
Figure 3. Overview of available error models in InSilicoSeq 2.0. The mean quality scores of the forward reads are indicated by a red line and reverse reads by a green line. Each subfigure shows the per-base mean quality scores for the precomputed error models: MiSeq (A), MiSeq-20 (B), MiSeq-24 (C), MiSeq-28 (D), MiSeq-32 (E), MiSeq-36 (F), NextSeq (G), NovaSeq (H) and HiSeq (I). PHRED quality scores are analyzed by FastQC and the figures are generated by the R-package fastqcr.

Validating sequencing errors

InSilicoSeq has the option to store the positions of the sequencing errors it simulates on a read. When the parameter --store_mutations is passed, a vcf-formatted file containing the position and error for each read is created. The vcf file can be used as ground-truth data for detecting and correcting sequencing errors and consensus building.

To validate the logging of the sequencing errors, we make a multiple sequence alignment (MSA) of a forward and reverse read to the amplicon template. First, we take the first amplicon template from the hs_igh_naive_01.fasta file and select the first matching forward and reverse read of the two fastq files (hs_igh_naive_01_R1.fastq and hs_igh_naive_01_R2.fastq) (please note that the reverse read must be converted to a forward orientation by taking the reverse complement). This results in the following sequences:

Amplicon template and generated Fasta sequences
>1GTTGCACCTAACGTgaggtgcagctggtgcagtctggagcagaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttctggatacagctttaccagctactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgactctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgagacatccggggctcgtcccctttgactactggggccaaggaaccctggtcaccgtctcctca >1_0_0/1GTTGCACCTAACGTgaggtgcagctggtgcagtctggagcagaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttctggatacagctttaccagctactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgactctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgGaggcctcggacaccgccatgtattaTtg >1_0_0/2gaagatctccCgtaagggttctggatacTgctttaccagctacCggaCcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgactctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattaTtgtgcgagacatccggggctcgtcccctttgactactggggccaaggaaccctggtcaccgtctcctca

>1 is the amplicon template, >1_0_0/1 is the first forward-oriented read based of amplicon template >1 and >1_0_0/2 is the reverse-complemented sequence of the first reverse-oriented read of amplicon template >1. The web-based version of Clustal Omega8 was used to align the two reads to the amplicon template yielding the following result:

Alignment of the two reads to amplicon template
CLUSTAL O(1.2.4) multiple sequence alignment 1_0_0/1      GTTGCACCTAACGTgaggtgcagctggtgcagtctggagcagaggtgaaaaagcccgggg	601            GTTGCACCTAACGTgaggtgcagctggtgcagtctggagcagaggtgaaaaagcccgggg	601_0_0/2      ------------------------------------------------------------	0 1_0_0/1      agtctctgaagatctcctgtaagggttctggatacagctttaccagctactggatcggct	1201            agtctctgaagatctcctgtaagggttctggatacagctttaccagctactggatcggct	1201_0_0/2      -------gaagatctccCgtaagggttctggatacTgctttaccagctacCggaCcggct	53                    ********** ***************** ************** *** ***** 1_0_0/1      gggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgact	1801            gggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgact	1801_0_0/2      gggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgact	113             ************************************************************ 1_0_0/1      ctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtcca	2401            ctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtcca	2401_0_0/2      ctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtcca	173             ************************************************************ 1_0_0/1      tcagcaccgcctacctgcagtggagcagcctgGaggcctcggacaccgccatgtattaTt	3001            tcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattact	3001_0_0/2      tcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattaTt	233             ******************************** ************************* * 1_0_0/1      g-----------------------------------------------------------	3011            gtgcgagacatccggggctcgtcccctttgactactggggccaaggaaccctggtcaccg	3601_0_0/2      gtgcgagacatccggggctcgtcccctttgactactggggccaaggaaccctggtcaccg	293             * 1_0_0/1      --------	3011            tctcctca	3681_0_0/2      tctcctca	301

Based on the MSA, we can easily identify the position of the errors: A missing asterisk (*) reveals the position of the mismatches between the reads and the template. For read 1_0_0/1 at position 273, an A changed to a T, and at position 299, a C changed to a T. For read 1_0_0/2 at position 70, a G changed to an A; at position 254 an A to a G; at position 258 an A to a G; at position 273, a T to an A and at position 291 an A to a G. The locations of these seven errors could all be validated by the content of the hs_igh_naive_01.vcf file:

##fileformat=VCFv4.1#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO1_0_0/1	273	.	a	G	9		1_0_0/1	299	.	c	T	8		1_0_0/2	70	.	g	A	38		1_0_0/2	254	.	a	G	8		1_0_0/2	258	.	a	G	10		1_0_0/2	273	.	t	A	9		1_0_0/2	291	.	a	G	8		

This optional vcf-formatted file has the purpose of being used as ground-truth data for detecting and correcting sequencing errors.

Uploading simulated data to the ENPICOM Platform

As we mentioned earlier, simulating reads can be very valuable for benchmarking tool performance. To demonstrate that the sequencing data created by InSilicoSeq can be used for this purpose, we upload the simulated reads into the ENPICOM Platform. The ENPICOM Platform is an end-to-end software solution that we developed to enable any scientist to efficiently analyse immune repertoire sequencing data. Once the read files hs_igh_naive_01_R1.fastq and hs_igh_naive_01_R2.fastq are successfully uploaded into the platform, we need to construct a sequence template.

Figure 4. Constructing a sequence template in the ENPICOM Platform: The simulated reads start with a UMI of 10 nucleotides and a spacer consisting of the sequence “ACGT” followed by an immunoglobulin heavy receptor (IGH).
Figure 4. Constructing a sequence template in the ENPICOM Platform: The simulated reads start with a UMI of 10 nucleotides and a spacer consisting of the sequence “ACGT” followed by an immunoglobulin heavy receptor (IGH).

Now we can analyse the simulated reads. For each read pair, we can determine its fate during read processing: For our simulated dataset of 5000 read pairs, around 4% (N=204) were discarded because of quality issues. Based on the detailed read-fate overview, it could be determined that errors altering the spacer sequence and leading to a non-productive CDR3 region are the main reasons for reads-pairs to be discarded. These read fates are expected in our simulated dataset where sequencing errors occasionally alter the spacer sequence or result in a non-productive receptor sequence.

Figure 5. Around 4% of the simulated reads are discarded by the ENPICOM Platform mainly due to sequencing errors altering the spacer sequence and errors leading to non-productive receptor sequences.
Figure 5. Around 4% of the simulated reads are discarded by the ENPICOM Platform mainly due to sequencing errors altering the spacer sequence and errors leading to non-productive receptor sequences.

Testing the error correction of the ENPICOM Platform using simulated data

The simulated data can serve as a golden standard set to test the error correction and template-building algorithms. In our example, we know the sequence for each amplicon template (hs_igh_naive_01.fasta)

Amplicon 2 sequence used by InSilicoSeq to simulate reads
>2CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca

For each amplicon template we know what the simulated forward and reverse reads are based on the fastq read identifiers: The read identifiers of the InSilicoSeq fastq-files are always starting with the header of the template sequence. For this example, we can extract all the reads that are simulated for template >2 (from hs_igh_naive_01.fasta) by extracting the reads that start with @2_ from the fastq files (hs_igh_naive_01_R1.fastq and hs_igh_naive_01_R2.fastq) and convert those to fasta format that will be used later to create an MSA.

Forward reads simulated by InSilicoSeq for amplicon 2 in fasta format
>2_0_0/1CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactg>2_1_0/1CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagCagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctTgacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactg>2_2_0/1CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacCggcccctggacaagggcttgagtggatgggatggatGagcgTttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatcCgacgAacacggccCtgtattacG>2_3_0/1CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagTtgaggagcctgagatctgacgacacgAccgtgGattactg>2_4_0/1CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacGtccacgagcacagcctacatggagctgaTgagcctgagatctgacCacacggccTtgtattactg
Reversed reads simulated by InSilicoSeq for amplicon 2 in fasta format
>2_0_0/2AtcctgcaaggcttcCgTttacacctttaccagGtatggtatcagctgggtgcgacTggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca>2_1_0/2ctcctgcaaggcttTtggCtacacctttaccGgctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaCtggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca>2_2_0/2ctcctgcaaggctActggttacacctttaccagctatggtatcagAtgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaaActccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca>2_3_0/2ctGctgcaaggcttctggttacTcctttaccagctatggtatcagctTggtgcgacaAgcccctggacaagggctCgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca>2_4_0/2ctcctgcaaggcttctggttacacctttaccagctatggtaGcagctgTgtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatTaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca

For each read, we know the exact position of each error introduced by InSilicoSeq (from hs_igh_naive_01.vcf). Based on the 5 simulated read-pairs and the amplicon template, we can do a MSA to see the distribution of mismatches between the reads and the template using Clustal Omega.

Clustal Omega MSA of amplicon template with the forward and reverse reads generated by InSilicoSeq
CLUSTAL O(1.2.4) multiple sequence alignment 2_0_0/1         CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctgggg	602_1_0/1         CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagCagcctgggg	602_2_0/1         CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctgggg	602_3_0/1         CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctgggg	602_4_0/1         CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctgggg	602_amplicon      CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctgggg	602_0_0/2         ------------------------------------------------------------	02_1_0/2         ------------------------------------------------------------	02_2_0/2         ------------------------------------------------------------	02_3_0/2         ------------------------------------------------------------	02_4_0/2         ------------------------------------------------------------	0 2_0_0/1         cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	1202_1_0/1         cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	1202_2_0/1         cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	1202_3_0/1         cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	1202_4_0/1         cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	1202_amplicon      cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	1202_0_0/2         -------------AtcctgcaaggcttcCgTttacacctttaccagGtatggtatcagct	472_1_0/2         -------------ctcctgcaaggcttTtggCtacacctttaccGgctatggtatcagct	472_2_0/2         -------------ctcctgcaaggctActggttacacctttaccagctatggtatcagAt	472_3_0/2         -------------ctGctgcaaggcttctggttacTcctttaccagctatggtatcagct	472_4_0/2         -------------ctcctgcaaggcttctggttacacctttaccagctatggtaGcagct	47                              * **********   *  *** ******** * ******* *** * 2_0_0/1         gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	1802_1_0/1         gggtgcgacaggcccctTgacaagggcttgagtggatgggatggatcagcgcttacaatg	1802_2_0/1         gggtgcgacCggcccctggacaagggcttgagtggatgggatggatGagcgTttacaatg	1802_3_0/1         gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	1802_4_0/1         gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	1802_amplicon      gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	1802_0_0/2         gggtgcgacTggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	1072_1_0/2         gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaCtg	1072_2_0/2         gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	1072_3_0/2         TggtgcgacaAgcccctggacaagggctCgagtggatgggatggatcagcgcttacaatg	1072_4_0/2         gTgtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	107                  *******  ****** ********** ***************** **** ***** ** 2_0_0/1         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	2402_1_0/1         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	2402_2_0/1         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	2402_3_0/1         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	2402_4_0/1         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacGtcca	2402_amplicon      gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	2402_0_0/2         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	1672_1_0/2         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	1672_2_0/2         gtaacacaaactatgcacagaaActccagggcagagtcaccatgaccacagacacatcca	1672_3_0/2         gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	1672_4_0/2         gtaacacaaactatgcacagaagctccagggcagagtcaccatTaccacagacacatcca	167                ********************** ******************** *********** **** 2_0_0/1         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	3002_1_0/1         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	3002_2_0/1         cgagcacagcctacatggagctgaggagcctgagatcCgacgAacacggccCtgtattac	3002_3_0/1         cgagcacagcctacatggagTtgaggagcctgagatctgacgacacgAccgtgGattact	3002_4_0/1         cgagcacagcctacatggagctgaTgagcctgagatctgacCacacggccTtgtattact	3002_amplicon      cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	3002_0_0/2         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	2272_1_0/2         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	2272_2_0/2         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	2272_3_0/2         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	2272_4_0/2         cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	227                ******************** *** ************ *** *      *      * 2_0_0/1         g-----------------------------------------------------------	3012_1_0/1         g-----------------------------------------------------------	3012_2_0/1         G-----------------------------------------------------------	3012_3_0/1         g-----------------------------------------------------------	3012_4_0/1         g-----------------------------------------------------------	3012_amplicon      gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	3602_0_0/2         gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	2872_1_0/2         gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	2872_2_0/2         gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	2872_3_0/2         gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	2872_4_0/2         gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	287                * 2_0_0/1         --------------	3012_1_0/1         --------------	3012_2_0/1         --------------	3012_3_0/1         --------------	3012_4_0/1         --------------	3012_amplicon      tcaccgtctcttca	3742_0_0/2         tcaccgtctcttca	3012_1_0/2         tcaccgtctcttca	3012_2_0/2         tcaccgtctcttca	3012_3_0/2         tcaccgtctcttca	3012_4_0/2         tcaccgtctcttca	301

Based on this MSA, we can easily identify the position of the errors: A missing asterisk (*) reveals the position where one of the simulated reads contains a sequencing error. Next, we would like to see if the ENPICOM Platform can reconstruct the template sequence based on the simulated reads that include sequencing errors. We can easily query the output of the ENPICOM Platform analyses on the simulated data and extract the consensus sequence:

Consensus sequence created by the ENPICOM Platform based on the forward and reverse reads generated by InSilicoSeq
>2_consensus_IGXcaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttca

To validate that the consensus-building algorithm of the ENPICOM Platform is working correctly, all the read errors should be corrected and the consensus sequence should be identical to that of the amplicon template present in hs_igh_naive_01.fasta excluding the UMI (10 random nucleotides) and the spacer sequence (“ACGT”). Once again, we use Clustal Omega to align the amplicon template sequence >2 of hs_igh_naive_01.fasta to the consensus sequence determined by the ENPICOM Platform. Based on the result, we can see that our software corrected each sequencing error and that the consensus sequence perfectly aligns with the amplicon template that was used to generate the reads.

Clustal Omega alignment between the amplicon sequence and the ENPICOM Platform consensus sequence
CLUSTAL O(1.2.4) multiple sequence alignment 2_consensus_IGX      --------------CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGG	462_amplicon           CGCATACGATACGTcaggttcagctggtgcagtctggagctgaggtgaagaagcctgggg	60                                   ********************************************** 2_consensus_IGX      CCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCAGCTATGGTATCAGCT	1062_amplicon           cctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagct	120                     ************************************************************ 2_consensus_IGX      GGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATG	1662_amplicon           gggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatg	180                     ************************************************************ 2_consensus_IGX      GTAACACAAACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCA	2262_amplicon           gtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatcca	240                     ************************************************************ 2_consensus_IGX      CGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACT	2862_amplicon           cgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattact	300                     ************************************************************ 2_consensus_IGX      GTGCGAGAGAGAGCGGTGACTACCCTGATGCTTTTGATGTCTGGGGCCAAGGGACAATGG	3462_amplicon           gtgcgagagagagcggtgactaccctgatgcttttgatgtctggggccaagggacaatgg	360                     ************************************************************ 2_consensus_IGX      TCACCGTCTCTTCA	3602_amplicon           tcaccgtctcttca	374                     **************

Conclusions

In this blogpost, we illustrated how we use our newly published tool InSilicoSeq to test the ENPICOM Platform, our software solution for immune repertoire data analysis.

  • We demonstrated the novel amplicon sequencing feature of InSilicoSeq by simulating a template including a UMI, a spacer and a set of IGH receptors, and generating an AIRR sequencing data consisting of 5000 paired-end reads with a length of 301 base pairs using an Illumina MiSeq-based error model.
  • We showed that the InSilicoSeq produces realistic amplicon-based sequencing reads that closely resemble the PHRED scores of empirical reads. Errors are introduced as expected and documented in a VCF file.
  • We applied InSilicoSeq’s utility in tool benchmarking by showing that a correct consensus sequence is constructed by the ENPICOM Platform; the simulated read errors are corrected back to the ground truth template that was used for read simulation.

If you are interested in learning how to get the most out of your AIRR-seq data with our tailored software and service solutions, talk to our experts about your research project today.

References

  1. Lelieveld SH, Maas T, Duk TCX, Gourlé H, van den Ham H-J. InSilicoSeq 2.0: simulating realistic amplicon-based sequence reads. Preprint on BioRxiv (2024). doi: 10.1101/2024.02.16.580469
  2. Gourlé H, Karlsson-Lindsjö O, Hayer J, Bongcam-Rudloff E. Simulating Illumina data with InSilicoSeq. Bioinformatics (2018). doi: 10.1093/bioinformatics/bty630
  3. Weber CR, Akbar R, Yermanos A, Pavlović M, Snapkov I, Sandve GK, Reddy ST, Greiff V. immuneSIM: tunable multi-feature simulation of B- and T-cell receptor repertoires for immunoinformatics benchmarking. Bioinformatics (2020). doi: 10.1093/bioinformatics/btaa158
  4. Charif D, Lobry J. SeqinR 1.0-2: a contributed package to the R project for statistical computing devoted to biological sequences retrieval and analysis. In: Bastolla U, Porto M, Roman H, Vendruscolo M (eds.) Structural Approaches to Sequence Evolution, 207–232. Springer, New York (2007). ISBN 978-3-540-35305-8. doi: 10.1093/bioinformatics/bti037
  5. Andrews S. FastQC: a quality-control tool for high-throughput sequence data. Babraham Bioinformatics (2010).
  6. Kassambara A. fastqcr: quality control of sequencing data. R package version 0.1.3 (2023).
  7. Ewing B, Green P. Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Research (1998). doi: 10.1101/gr.8.3.186
  8. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular Systems Biology (2011). doi: 10.1038/msb.2011.75